Prev. | 

RIKEN DNA Bank Human Resource - COMMD8

Gene ID NCBI Gene 54951 |  KEGG hsa:54951
Gene Symbol COMMD8
Protein Name COMM domain containing 8
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017047 IRAK042K07 pCMV-SPORT6 BC019826 NM_017845 Full/var
HGY086774 IRAL016P14 pDNR-LIB BC008371 NM_017845 Full
HGY092772 IRAL031P12 pDNR-LIB BC015145 NM_017845 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044481 ARe11D09 pKA1U5 NM_017845.3  
GTTCGCGCAGGGATGGAGCCGGAAGAGGGGACGCCCTTGTTGGCGGCTGCAGAAGCTGCC
HKR064572 ARe61H04 pKA1U5 NM_017845.3  
ACCTCTTTGTCAGAGATAAACAAGAACAAATACNCTATACTTATGTGAACAGTTTTGAGT
HKR082005 ARf05A05 pKA1U5 NM_017845.3  
GACCCAAGCCCCAGCTTCGCGCAGGGATGGAGCCGGAAGAGGGGACGCCCTTGTGGCGGC
HKR168905 ARi22E09 pGCAP10 NM_017845.3  
GGCGCAGGGATGGAGCCGGAAGAGGGGACGCCCTTGTGGCGGCTGCAGAAGCTGCCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl