Prev. |  KEGG KO K15122 > 

RIKEN DNA Bank Human Resource - SLC41A3

Gene ID NCBI Gene 54946 |  KEGG hsa:54946
Gene Symbol SLC41A3
Protein Name solute carrier family 41 member 3
Synonyms SLC41A1-L2
Ortholog resource in our bank

  SLC41A3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005203 IRAK013A03 pCMV-SPORT6 BC009039 NM_001008485 Full
HGX025134 IRAK062N22 pCMV-SPORT6 BC028241 NM_017836 Partial/var
HGX031946 IRAK079O10 pCMV-SPORT6 BC035753 NM_017836 Full/var
HGY089349 IRAL023G05 pOTB7 BC009444 NM_017836 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234084 ARiS085D12 pGCAP10 NM_017836.3  
GCTCTTTTCCGCCGCCGCCTGGGAGGGGACCCGGGCTGCCAGGCGCCCAGCTGTGCCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl