Prev. | 

RIKEN DNA Bank Human Resource - COMMD4

Gene ID NCBI Gene 54939 |  KEGG hsa:54939
Gene Symbol COMMD4
Protein Name COMM domain containing 4
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001787 IRAK004H19 pCMV-SPORT6 BC000837 NM_017828 Partial
HGX027498 IRAK068M10 pCMV-SPORT6 BC033744 NM_017828 Partial/var
HGX033674 IRAK084D02 pCMV-SPORT6 BC040944 NM_017828 Partial/var
HGY101980 IRAL054P20 pOTB7 BC068998 NM_017828 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071628 ARe79B04 pKA1U5 NM_017828.3  
GAGAAATTCCCGGGCCCTGGCTTCTTGGCGCGATGAGGTTCCGGTTCTGTGGTGATCTGG
HKR183707 ARi59E11 pGCAP10 NM_017828.3  
GATTCCCGGGCCCTGGCTTCTTGGCGCGATGAGGTTCCGGTTCTGTGGTGATCTGGACTG
HKR277778 ARiS194H10 pGCAP10 NM_017828.3  
TGGGCTTCTTGGCGCGATGAGGTTCCGGTTCTGTGGTGATCTGGACTGTCCCGACTGGGT
HKR334403 RBb36A03 pGCAP1 NM_017828.3  
GGCCCTGGCTTCTTGGCGCGATGAGGTTCCGGTTCTGTGGTGATCTGGACTGTCCCGACT
HKR336833 RBb42B09 pGCAP1 NM_017828.3  
GATTCCCGGGCCCTGGCTTCTTGGCGCGATGAGGTTCCGGTTCTGTGGTGATCTGGACTG
HKR336976 RBb42H08 pGCAP1 NM_017828.3  
GATTCCCGGGCCCTGGGCTTCTTGGNGCGATGANGTTCCNGTTCTGCTGNCTGATNTGGA
HKR405696 RBdS014D24 pGCAP10 NM_017828.3  
GATGGTGAGGCACTAGGGGCGAAGCGAGGCTTGGGCTGCTGGAGCGGGAATGAGGGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl