Prev. |  KEGG KO K15759 > 

RIKEN DNA Bank Human Resource - IMPAD1

Gene ID NCBI Gene 54928 |  KEGG hsa:54928
Gene Symbol IMPAD1
Protein Name inositol monophosphatase domain containing 1
Synonyms GPAPP|IMP 3|IMP-3|IMPA3
Ortholog resource in our bank

  IMPAD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067295 IRAK168D23 pBluescriptR BC067814 NM_017813
HGY094484 IRAL036D12 pDNR-LIB BC017797 NM_017813 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059208 ARe48A08 pKA1U5 NM_017813.3  
GGCNCTGCCTGGCGAGTCAGGCGCGNGGGGCNCCTTNAGNGGTCTTCGCGGCGACAACTC
HKR430234 RBdS075J18 pGCAP10 NM_017813.3  
GGCGGCCGTAGGCTAACGTGGAAGTCGGACCAGCCGGCCGGCGGAAGAACCTAGAGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl