Prev. |  KEGG KO K11270 > 

RIKEN DNA Bank Human Resource - CHTF8

Gene ID NCBI Gene 54921 |  KEGG hsa:54921
Gene Symbol CHTF8
Protein Name chromosome transmission fidelity factor 8
Synonyms CTF8|DERPC
Ortholog resources KEGG ortholog (KEGG orthology K11270) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056210 IRAK140I18 pCMV-SPORT6 BC069059 NM_001039690 Full
HGY084549 IRAL011G05 pOTB7 BC018700 NM_001039690 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041275 ARe03D03 pKA1U5 NM_001039690.2  
GGGCGGCGACGGCGGCGGGAGGTTCGGTTGTCGCCCGTTTGGCCGCGCGGCGCCGCGCTC
HKR331202 RBb28A02 pGCAP1 NM_001039690.2  
TGGTCGGAAGTGCGCAGGCAGTGCTCGCGGCGGCGGCGACGGCGGCGGGAGGTTCGGTTG
HKR338075 RBb45D03 pGCAP1 NM_001039690.2  
GGGGAGCGAGCGGGGCGGAGCGGGAGAAGGGCGGAAAGGGTGGCCGAGCGCGGGCGGAGG
HKR375322 RBd38F02 pGCAP10 NM_001039690.2  
GGCAGGCAGTGCTCGCGGCGGCGGCGACGGCGGCGGGAGGTTCGGTTGTCGCCCGTTGGC
HKR382477 RBd56D05 pGCAP10 NM_001039690.2  
GAGTGCTCGCGGCGGCGGCGACGGCGGCGGGAGGTTCGGTTNNNNNCCGTTGGCCGCGCG
HKR384073 RBd60D01 pGCAP10 NM_001039690.2  
GATAGTCGGAAGTGCGCAGGCAGTGCTCGCGGCGGCGGCGACGGCGGCGGGAGGTTCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl