Prev. |  KEGG KO K19759 > 

RIKEN DNA Bank Human Resource - DNAAF5

Gene ID NCBI Gene 54919 |  KEGG hsa:54919
Gene Symbol DNAAF5
Protein Name dynein axonemal assembly factor 5
Synonyms CILD18|HEATR2
Ortholog resource in our bank

  DNAAF5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY042689 IRAK106M01 pBluescript BC047240 NM_017802
HGX069943 IRAK174O07 pCMV-SPORT6 BC072425

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE121235 M01C103B11 pDONR221 06_12-C06 BC047240 NM_017802  
HGE121283 M01C103D11 pDONR221 06_12-C06 BC047240 NM_017802  
HGE121331 M01C103F11 pDONR221 06_12-C06 BC047240 NM_017802  
HGE121379 M01C103H11 pDONR221 06_12-C06 BC047240 NM_017802  
HGE121427 M01C103J11 pDONR221 06_12-C06 BC047240 NM_017802  
HGE121475 M01C103L11 pDONR221 06_12-C06 BC047240 NM_017802  
HGE121523 M01C103N11 pDONR221 06_12-C06 BC047240 NM_017802  
HGE121571 M01C103P11 pDONR221 06_12-C06 BC047240 NM_017802  
HGE125235 M01C113B11 pDONR221 06-2_05-C06 BC047240 NM_017802  
HGE125283 M01C113D11 pDONR221 06-2_05-C06 BC047240 NM_017802  
HGE125331 M01C113F11 pDONR221 06-2_05-C06 BC047240 NM_017802  
HGE125379 M01C113H11 pDONR221 06-2_05-C06 BC047240 NM_017802  
HGE125427 M01C113J11 pDONR221 06-2_05-C06 BC047240 NM_017802  
HGE125475 M01C113L11 pDONR221 06-2_05-C06 BC047240 NM_017802  
HGE125523 M01C113N11 pDONR221 06-2_05-C06 BC047240 NM_017802  
HGE125571 M01C113P11 pDONR221 06-2_05-C06 BC047240 NM_017802  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078155 ARe95G11 pKA1U5 NM_017802.3  
GGCCCTGCCGCGCCTGCTGCCCGCGCTCGCCGCGCGCTTGGCCGGCCCCGTGCCCGCGCG
HKR234344 ARiS085O08 pGCAP10 NM_017802.3  
GCCCTTCGCCGCCGTGCGCCGCGAGAGCTGCAGCTGCGCCGCCGCCCTGGCGCAGGCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl