Prev. |  KEGG KO K15865 > 

RIKEN DNA Bank Human Resource - CDKAL1

Gene ID NCBI Gene 54901 |  KEGG hsa:54901
Gene Symbol CDKAL1
Protein Name CDK5 regulatory subunit associated protein 1 like 1
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K15865) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056701 IRAK141M13 pCMV-SPORT6.1 BC064145 NM_017774 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR387708 RBd69E12 pGCAP10 NM_017774.2  
GGTATGTGTCATGGCGCTCTCCATCTAAAGTCTGTGCAGCTTCCGGAGAGTGGCGGGTTG
HKR391348 RBd78G04 pGCAP10 NM_017774.2  
GAGAGTGGCGGGTTGATTTTCTCACTTTGGACTGGTTTTTACTTCCCGACTTCTGGACTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl