Prev. |  KEGG KO K18085 > 

RIKEN DNA Bank Human Resource - MTMR10

Gene ID NCBI Gene 54893 |  KEGG hsa:54893
Gene Symbol MTMR10
Protein Name myotubularin related protein 10
Synonyms -
Ortholog resource in our bank

  MTMR10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR428305 RBdS070M17 pGCAP10 NM_017762.3 Full/var done
GCGCCTGACCCCTGCGGGCCGCCGTAGAAGGACCCTCCAGAGGCCGCGCTCTTGAGATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl