Prev. | 

RIKEN DNA Bank Human Resource - TMEM214

Gene ID NCBI Gene 54867 |  KEGG hsa:54867
Gene Symbol TMEM214
Protein Name transmembrane protein 214
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066890 IRAK167D18 pBluescriptR BC068479 NM_017727 Full
HGY082032 IRAL005B08 pOTB7 BC002467 NM_017727 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172834 ARi32B10 pGCAP10 NM_017727.4  
GAAAAGCCGGGGAAGTGGCCGAGGAGGGAGGGCTGCGAGCCATGGCGACCAAGACGGCGG
HKR264480 ARiS161D08 pGCAP10 NM_017727.4  
GGCCGGACCGGAAAGCCGGGNAANTGGCCGAGGAGGGAGGGCTGCGAGCCATGGCGACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl