Prev. | 

RIKEN DNA Bank Human Resource - GPATCH4

Gene ID NCBI Gene 54865 |  KEGG hsa:54865
Gene Symbol GPATCH4
Protein Name G-patch domain containing 4
Synonyms GPATC4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033619 IRAK084A19 pCMV-SPORT6 BC040147 NM_182679 Partial
HGX047602 IRAK119A02 pCMV-SPORT6 BC056904 NM_182679 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE126821 M01C117A21 pDONR221 3_5-A11 BC056904 NM_182679  
HGE112837 M01C082B13 pDONR221 IMS04-G07 AK055377 ENST00000292337  
HGE112885 M01C082D13 pDONR221 IMS04-G07 AK055377 ENST00000292337  
HGE112933 M01C082F13 pDONR221 IMS04-G07 AK055377 ENST00000292337  
HGE112981 M01C082H13 pDONR221 IMS04-G07 AK055377 ENST00000292337  
HGE113029 M01C082J13 pDONR221 IMS04-G07 AK055377 ENST00000292337  
HGE113077 M01C082L13 pDONR221 IMS04-G07 AK055377 ENST00000292337  
HGE113125 M01C082N13 pDONR221 IMS04-G07 AK055377 ENST00000292337  
HGE113173 M01C082P13 pDONR221 IMS04-G07 AK055377 ENST00000292337  
HGE095612 M01C039A12 pDONR221 MGC09-B06 BC056904 NM_182679  
HGE095660 M01C039C12 pDONR221 MGC09-B06 BC056904 NM_182679  
HGE095708 M01C039E12 pDONR221 MGC09-B06 BC056904 NM_182679  
HGE095756 M01C039G12 pDONR221 MGC09-B06 BC056904 NM_182679  
HGE095804 M01C039I12 pDONR221 MGC09-B06 BC056904 NM_182679  
HGE095852 M01C039K12 pDONR221 MGC09-B06 BC056904 NM_182679  
HGE095900 M01C039M12 pDONR221 MGC09-B06 BC056904 NM_182679  
HGE095948 M01C039O12 pDONR221 MGC09-B06 BC056904 NM_182679  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR402803 RBdS007A03 pGCAP10 NM_015590.2  
GAAGATGGCGGCGCACAAGTCAGGTCCGGCACATGTTTCCGCGGAGCGGACCCAGCAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl