Prev. |  KEGG KO K18260 > 

RIKEN DNA Bank Human Resource - CC2D1A

Gene ID NCBI Gene 54862 |  KEGG hsa:54862
Gene Symbol CC2D1A
Protein Name coiled-coil and C2 domain containing 1A
Synonyms FREUD-1|Freud-1/Aki1|MRT3
Ortholog resource in our bank

  CC2D1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037478 IRAK093L14 pCMV-SPORT6 BC048345 NM_017721 Partial/var
HGY081079 IRAL002L15 pOTB7 BC006556 NM_017721 Partial/var
HGY100357 IRAL050O21 pOTB7 BC064981 NM_017721

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009105 W01A022M17 pENTR-TOPO IRAL050O21 BC064981 NM_017721  
HGE009109 W01A022M21 pENTR-TOPO IRAL050O21 BC064981 NM_017721  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR379752 RBd49G08 pGCAP10 NM_017721.3  
GGGCAGACCCGGCGAGCCCAGTGGCCGCGCTCCGGTGCGGCGGCGCCCGAGGCCCGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl