Prev. | 

RIKEN DNA Bank Human Resource - DEF8

Gene ID NCBI Gene 54849 |  KEGG hsa:54849
Gene Symbol DEF8
Protein Name differentially expressed in FDCP 8 homolog
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178575 ARi46H07 pGCAP10 NM_017702.2  
GGAGACAGATGCGAGGCGGCGGTCAGGTGCCGAACCCACGGCCAGGCTTCCGTGGCCAGC
HKR378553 RBd46G09 pGCAP10 NM_017702.2  
GAGACAGATGCGAGGCGGCGGTCAGCAGGTGCCGAACCCACGGCCAGGCTTCCGTGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl