Prev. | 

RIKEN DNA Bank Human Resource - ZCCHC10

Gene ID NCBI Gene 54819 |  KEGG hsa:54819
Gene Symbol ZCCHC10
Protein Name zinc finger CCHC-type containing 10
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086610 IRAL016I18 pDNR-LIB BC005211 NM_017665 Full
HGY092989 IRAL032H21 pDNR-LIB BC015986 NM_017665 Partial
HGY094344 IRAL035O08 pDNR-LIB BC022443 NM_017665 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR323369 RBb08H01 pKA1U5 NM_017665.1  
ATCCTGGGCTTTGACCGCGCTAAGATGGCGACTCCCATGCATCGGCTAATAGCCCGGAGA
HKR380857 RBd52C09 pGCAP10 NM_017665.1  
TGCCTGCGCGGCCGGCTTTGACCGCGCTAAGATGGCGACTCCCATGCATCGGCTAATAGC
HKR398480 RBd96D08 pGCAP10 NM_017665.1  
GGCTAAGATGGCGACTCCCATGCATCGGCTAATAGCCCGGAGACAAGCTGAAGCAAATAA
HKR402811 RBdS007A11 pGCAP10 NM_017665.1  
GGGCTTTGACCGCGCTAAGATGGCGACTCCCATGCATCGGCTAATAGCCCGGAGACAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl