Prev. |  KEGG KO K10461 > 

RIKEN DNA Bank Human Resource - KLHL24

Gene ID NCBI Gene 54800 |  KEGG hsa:54800
Gene Symbol KLHL24
Protein Name kelch like family member 24
Synonyms DRE1|EBSSH|KRIP6
Ortholog resource in our bank

  KLHL24

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR453050 RBdS132K10 pGCAP10 NM_017644.3 done
GACTGGTGGCTGGAGGAGACGCCGGCGCTGGAGAGTGCGCTGCGCCGCCCGCCGCTGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl