RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - KLHL24

Gene ID	NCBI Gene 54800 \| KEGG hsa:54800
Gene Symbol	KLHL24
Protein Name	kelch like family member 24
Synonyms	DRE1\|EBSSH\|KRIP6

Ortholog resource in our bank

  KLHL24

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR453050	RBdS132K10	pGCAP10	NM_017644.3	VA
HKR453050	GACTGGTGGCTGGAGGAGACGCCGGCGCTGGAGAGTGCGCTGCGCCGCCCGCCGCTGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl