Prev. | 

RIKEN DNA Bank Human Resource - KCTD9

Gene ID NCBI Gene 54793 |  KEGG hsa:54793
Gene Symbol KCTD9
Protein Name potassium channel tetramerization domain containing 9
Synonyms BTBD27
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067079 IRAK167L15 pBluescriptR BC068518 NM_017634 Full/var
HGY087115 IRAL017N03 pOTB7 BC021216 NM_017634 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE106021 M01C065A21 pDONR221 06_07-A11 BC021216 NM_017634  
HGE106069 M01C065C21 pDONR221 06_07-A11 BC021216 NM_017634  
HGE106117 M01C065E21 pDONR221 06_07-A11 BC021216 NM_017634  
HGE106165 M01C065G21 pDONR221 06_07-A11 BC021216 NM_017634  
HGE106213 M01C065I21 pDONR221 06_07-A11 BC021216 NM_017634  
HGE106261 M01C065K21 pDONR221 06_07-A11 BC021216 NM_017634  
HGE106309 M01C065M21 pDONR221 06_07-A11 BC021216 NM_017634  
HGE106357 M01C065O21 pDONR221 06_07-A11 BC021216 NM_017634  
HGE124443 M01C111B19 pDONR221 06-2_04-C10 BC021216 NM_017634  
HGE124491 M01C111D19 pDONR221 06-2_04-C10 BC021216 NM_017634  
HGE124539 M01C111F19 pDONR221 06-2_04-C10 BC021216 NM_017634  
HGE124587 M01C111H19 pDONR221 06-2_04-C10 BC021216 NM_017634  
HGE124635 M01C111J19 pDONR221 06-2_04-C10 BC021216 NM_017634  
HGE124683 M01C111L19 pDONR221 06-2_04-C10 BC021216 NM_017634  
HGE124731 M01C111N19 pDONR221 06-2_04-C10 BC021216 NM_017634  
HGE124779 M01C111P19 pDONR221 06-2_04-C10 BC021216 NM_017634  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR363252 RBd08C04 pGCAP10 NM_017634.2  
GAGCGGGGGCAGCGCGATGAGGCGGGTGACCCTGTTCCTGAACGGCAGCCCCAAGAACGG
HKR364172 RBd10H04 pGCAP10 NM_017634.2  
GAGGGGCGGGGTGGGAAGGAGGACCGGCCGAACCTTGGGTGTGGGACAGAGTGCGTGCGT
HKR462727 RBdS156N15 pGCAP10 NM_017634.2  
GNNNNCTTGGGTGTGGGACAGAGTGCGTGCGTGTGGTGTGTCCCCAAGGGCAGGAAGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl