Prev. |  KEGG KO K09518 > 

RIKEN DNA Bank Human Resource - DNAJB12

Gene ID NCBI Gene 54788 |  KEGG hsa:54788
Gene Symbol DNAJB12
Protein Name DnaJ heat shock protein family (Hsp40) member B12
Synonyms DJ10
Ortholog resource in our bank

  DNAJB12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056163 IRAK140G19 pCMV-SPORT6 BC064920 NM_017626 Full
HGY091213 IRAL028A13 pOTB7 BC011812 NM_017626 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022017 W01A055A17 pENTR-TOPO IRAK140G19 BC064920 NM_017626  
HGE022019 W01A055A19 pENTR-TOPO IRAK140G19 BC064920 NM_017626  
HGE022023 W01A055A23 pENTR-TOPO IRAK140G19 BC064920 NM_017626  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326054 RBb15C06 pKA1U5 NM_001002762.2  
TGGGCTGCCCGCGACGCGCCGGCGGGTGGCGCAGCCCTTCGCTCGCCCGGCCTCCCCCTC
HKR384100 RBd60E04 pGCAP10 NM_001002762.2  
GGGAATCTGGGCGTGCACCATTATTGACACCTACACCAGCCGTCCCTTTCTTAGAAGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl