Prev. |  KEGG KO K12020 > 

RIKEN DNA Bank Human Resource - TRIM44

Gene ID NCBI Gene 54765 |  KEGG hsa:54765
Gene Symbol TRIM44
Protein Name tripartite motif containing 44
Synonyms AN3|DIPB|HSA249128|MC7
Ortholog resource in our bank

  TRIM44

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010517 IRAK026E21 pCMV-SPORT6 BC013166 NM_017583 Full
HGY084577 IRAL011H09 pOTB7 BC024031 NM_017583 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113221 M01C083A21 pDONR221 IMS05-A11 BC013166 NM_017583  
HGE113269 M01C083C21 pDONR221 IMS05-A11 BC013166 NM_017583  
HGE113317 M01C083E21 pDONR221 IMS05-A11 BC013166 NM_017583  
HGE113365 M01C083G21 pDONR221 IMS05-A11 BC013166 NM_017583  
HGE113413 M01C083I21 pDONR221 IMS05-A11 BC013166 NM_017583  
HGE113461 M01C083K21 pDONR221 IMS05-A11 BC013166 NM_017583  
HGE113509 M01C083M21 pDONR221 IMS05-A11 BC013166 NM_017583  
HGE113557 M01C083O21 pDONR221 IMS05-A11 BC013166 NM_017583  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209346 ARiS023G02 pGCAP10 NM_017583.4  
GAGGGACAGAGCGGAGCAGGCCGAGCCGGCGGAAAGGGTCTTTGCTGCTGCGCCCGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl