Prev. | 

RIKEN DNA Bank Human Resource - KLHDC4

Gene ID NCBI Gene 54758 |  KEGG hsa:54758
Gene Symbol KLHDC4
Protein Name kelch domain containing 4
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017103 IRAK042M15 pCMV-SPORT6 BC022969 NM_017566
HGY082829 IRAL007B05 pOTB7 BC001044 NM_017566 Full/var
HGY090784 IRAL026P24 pOTB7 BC011680 NM_017566 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099233 M01C048B09 pDONR221 MGC13-G05 BC011680 ENST00000347925  
HGE099281 M01C048D09 pDONR221 MGC13-G05 BC011680 ENST00000347925  
HGE099329 M01C048F09 pDONR221 MGC13-G05 BC011680 ENST00000347925  
HGE099377 M01C048H09 pDONR221 MGC13-G05 BC011680 ENST00000347925  
HGE099425 M01C048J09 pDONR221 MGC13-G05 BC011680 ENST00000347925  
HGE099473 M01C048L09 pDONR221 MGC13-G05 BC011680 ENST00000347925  
HGE099521 M01C048N09 pDONR221 MGC13-G05 BC011680 ENST00000347925  
HGE099569 M01C048P09 pDONR221 MGC13-G05 BC011680 ENST00000347925  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR073773 ARe84H05 pKA1U5 NM_017566.2  
GTTTCTTTCCTGGTGTCCCGTCGCGGCTTGGGACCCGGCAAGATGGGCAAGAAGGGCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl