Prev. | 

RIKEN DNA Bank Human Resource - EPDR1

Gene ID NCBI Gene 54749 |  KEGG hsa:54749
Gene Symbol EPDR1
Protein Name ependymin related 1
Synonyms EPDR|MERP-1|MERP1|UCC1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007785 IRAK019H17 pCMV-SPORT6 BC018299 NM_017549 Partial
HGY082272 IRAL005L08 pOTB7 BC000686 NM_017549 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043379 ARe08H11 pKA1U5 NM_017549.3  
GAGAAGGCAGTGGCAGCAGGCAGTGGCCCAGGCAGAAATAGCTCCCGCGCGATTCACTGG
HKR170859 ARi27C11 pGCAP10 NM_017549.3  
GAGTGAAAACCGAAGCGGCAGAAGGCAGTGGCAGCAGGCAGTGGCAGCAGGCAGTGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl