Prev. |  KEGG KO K20346 > 

RIKEN DNA Bank Human Resource - TMED9

Gene ID NCBI Gene 54732 |  KEGG hsa:54732
Gene Symbol TMED9
Protein Name transmembrane p24 trafficking protein 9
Synonyms GMP25|HSGP25L2G|p24a2|p24alpha2|p25
Ortholog resource in our bank

  TMED9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081463 IRAL003K23 pOTB7 BC001123 NM_017510 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044101 ARe10E05 pKA1U5 NM_017510.4  
TAGGTGGAGCAAGATGGCTGTGGAGCTGGGCGNGCTNCTCGTCCGGCCCCGGCCCGGAAC
HKR069380 ARe73H12 pKA1U5 NM_017510.4  
GAGGTGGAGCAAGATGGCTGTGGAGCTGGGCNCCCTTNATCGTCCGGCCCCGGCCCGGAA
HKR070812 ARe77A12 pKA1U5 NM_017510.4  
GAGGTGGAGCAAGATGGCTGTGGAGCTGGGCCCGNTTGCATCGTCCGGCCCCGGCCCGGA
HKR165725 ARi14F05 pGCAP10 NM_017510.4  
GAGGTGGAGCAAGATGGCTGTGGAGCTGGGCGTGCTGCTCGTCCGGCCCCGGCCCGGAAC
HKR186898 ARi67E02 pGCAP10 NM_017510.4  
GAGGTGGAGCAAGATGGCTGTGGAGCTGGGCGTGCTGCTCGTCCGGCCCCGGCCCGGAAC
HKR218120 ARiS045E24 pGCAP10 NM_017510.4  
TGAGGTGGAGCAAGATGGCTGTGGAGCTGGGCGTGCTGCTCGTCCGGCCCCGGCCCGGAA
HKR234148 ARiS085G04 pGCAP10 NM_017510.4  
GAGGTGGAGCAAGATGGCTGTGGAGCTGGGCGTGCTGCTCGTCCGGCCCCGGCCCGGAAC
HKR238732 ARiS096N20 pGCAP10 NM_017510.4  
GAGGTGGAGCAAGATGGCTGTGGAGCTGGGCGTGCTGCTCGTCCGGCCCCGGCCCGGAAC
HKR243893 ARiS109M05 pGCAP10 NM_017510.4  
GAGGCANGTGGAGCAAGATGGCTGTGGAGCTGGGCGTGCTGCTCGTCCGGCCCCGGCCCG
HKR247371 ARiS118H03 pGCAP10 NM_017510.4  
GAGGTGGAGCAAGATGGCTGTGGAGCTGGGCGTGCTGCTCGTCCGGCCCCGGCCCGGAAC
HKR402974 RBdS007H06 pGCAP10 NM_017510.4  
GAGGTGGAGCAAGATGGCTGTGGAGCTGGGCGTGCTGCTCGTCCGGCCCCGGCCCGGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl