Prev. |  KEGG KO K06711 > 

RIKEN DNA Bank Human Resource - P4HTM

Gene ID NCBI Gene 54681 |  KEGG hsa:54681
Gene Symbol P4HTM
Protein Name prolyl 4-hydroxylase, transmembrane
Synonyms EGLN4|HIFPH4|P4H-TM|PH-4|PH4|PHD4
Ortholog resources KEGG ortholog (KEGG orthology K06711) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036274 IRAK090L10 pBluescript BC047566 NM_177938 Full/var
HGX053785 IRAK134H17 pCMV-SPORT6 BC060321 NM_177938 Partial/var
HGY082337 IRAL005O01 pOTB7 BC000580 NM_177938 Partial/var
HGY091021 IRAL027J05 pOTB7 BC011710 NM_177938 Full
HGY096359 IRAL040O23 pOTB7 BC018731 NM_177938 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099241 M01C048B17 pDONR221 MGC13-G09 BC011710 ENST00000318125  
HGE099289 M01C048D17 pDONR221 MGC13-G09 BC011710 ENST00000318125  
HGE099337 M01C048F17 pDONR221 MGC13-G09 BC011710 ENST00000318125  
HGE099385 M01C048H17 pDONR221 MGC13-G09 BC011710 ENST00000318125  
HGE099433 M01C048J17 pDONR221 MGC13-G09 BC011710 ENST00000318125  
HGE099481 M01C048L17 pDONR221 MGC13-G09 BC011710 ENST00000318125  
HGE099529 M01C048N17 pDONR221 MGC13-G09 BC011710 ENST00000318125  
HGE099577 M01C048P17 pDONR221 MGC13-G09 BC011710 ENST00000318125  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326453 RBb16C05 pKA1U5 NM_177938.2  
GGGTCCCGCGCGCTCCCACTCACTCGCCTGCTGTCGCTCTCCGGGCCGGGGCGACTTGGC
HKR377773 RBd44H05 pGCAP10 NM_177938.2  
GATCTGCTCGCGCGCCTACTTCCTGGTGCTGATGGTGTTCGTGCACCTGTACCTGGGTAA
HKR442321 RBdS105N09 pGCAP10 NM_177938.2  
GACCCCCGCGGCCCCTCCCCTGGGCGCGCGCGCGACCTGGGTGCCATGGCGGCAGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl