Prev. |  KEGG KO K08744 > 

RIKEN DNA Bank Human Resource - CRLS1

Gene ID NCBI Gene 54675 |  KEGG hsa:54675
Gene Symbol CRLS1
Protein Name cardiolipin synthase 1
Synonyms C20orf155|CLS|CLS1|GCD10|dJ967N21.6
Ortholog resources KEGG ortholog (KEGG orthology K08744) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY101740 IRAL054F20 pOTB7 BC069010 NM_019095 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324402 RBb11A02 pKA1U5 NM_019095.4  
GGGAGCGTGCTGGGGTGTGTAAAGTAGTATGGANGCAGCGGCTAGCCCAGTGTCTGAGTG
HKR335655 RBb39C07 pGCAP1 NM_019095.4  
HKR405493 RBdS013M05 pGCAP10 NM_019095.4  
GAAAGTAGTATGGAGGCAGCGGTAGCCCAGTGTCTGAGTGGTTGCCGGGTCTCCATGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl