Prev. |  KEGG KO K14841 > 

RIKEN DNA Bank Human Resource - WDR74

Gene ID NCBI Gene 54663 |  KEGG hsa:54663
Gene Symbol WDR74
Protein Name WD repeat domain 74
Synonyms Nsa1
Ortholog resource in our bank

  WDR74

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086910 IRAL017E14 pOTB7 BC006351 NM_018093 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072499 ARe81E03 pKA1U5 NM_018093.1  
TGGTCTGCCTCCNNGCTTTGTCATGGNGGCTGCTGCTGCACGCTGGAACCATGTGTGGNT
HKR222149 ARiS055G05 pGCAP10 NM_018093.1  
GGTCATGGCGGCTGCTGCTGCACGCTGGAACCATGTGTGGGTCGGCACCGAGACTGGGAT
HKR399273 RBd98D01 pGCAP10 NM_018093.1  
GGCCTCCAGGCTTTGTCATGGCGGCTGCTGCTGCACGCTGGAACCATGTGTGGGTCGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl