Prev. |  KEGG KO K14810 > 

RIKEN DNA Bank Human Resource - DDX56

Gene ID NCBI Gene 54606 |  KEGG hsa:54606
Gene Symbol DDX56
Protein Name DEAD-box helicase 56
Synonyms DDX21|DDX26|NOH61
Ortholog resource in our bank

  DDX56

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001691 IRAK004D19 pCMV-SPORT6 BC001235 NM_019082 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041350 ARe03G06 pKA1U5 NM_019082.2  
TTGAGCGCGTGCGTGCTGCGCTACTGAGCAGCGCCATGGAGGACTCTGAAGCACTGGGCT
HKR077748 ARe94G04 pKA1U5 NM_019082.2  
GACTGAGCAGCGCCATGGAAGGACTCTGAAGCACTGGGCTTCGAACACATGGGCCTCGAT
HKR081209 ARf03A09 pKA1U5 NM_019082.2  
GACTGAGCAGCGCCATGGAGGACTCTGAAGCACTGGGCTTCGAACACATGGGCCTCGATC
HKR348101 RBb70E05 pGCAP1 NM_019082.2  
ACCTGTTGGTGCATGAGCTGATCTCTCCTAACCTAACAGCCAGATGCTAGTCTCTGGTAC
HKR397380 RBd93H12 pGCAP10 NM_019082.2  
GACTGAGCAGCGCCATGGAGGACTCTGAAGCACTGGGCTTCGAACACATGGGCCTCGATC
HKR441666 RBdS104C18 pGCAP10 NM_019082.2  
GACTGAGCAGCGCCATGGAGGACTCTGAAGCACTGGGCTTCGAACACATGGGCCTCGATC
HKR474830 RBdS187B06 pGCAP10 NM_019082.2  
GGCTGCGCTACTGAGCAGCGCCATGGAGGACTCTGAAGCACTGGGCTTCGAACACATGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl