Prev. |  KEGG KO K14778 > 

RIKEN DNA Bank Human Resource - DDX49

Gene ID NCBI Gene 54555 |  KEGG hsa:54555
Gene Symbol DDX49
Protein Name DEAD-box helicase 49
Synonyms Dbp8|R27090_2
Ortholog resource in our bank

  DDX49

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001275 IRAK003D03 pCMV-SPORT6 BC000979 NM_019070 Full/var
HGY085049 IRAL012K09 pOTB7 BC002674 NM_019070

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR333684 RBb34D12 pGCAP1 NM_019070.3  
TTGGTCGGCGCGCGCCGGAAGCGCGGATCACACGGGCCCCTACAAGGGGCCCCTACAAGC
HKR405681 RBdS014D09 pGCAP10 NM_019070.3  
GGGGCCCCTACAAGGGGCCCCTACAAGCGGCCACAAGGATGGCAGGCTTCGCGGAGCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl