Prev. |  KEGG KO K08270 > 

RIKEN DNA Bank Human Resource - DDIT4

Gene ID NCBI Gene 54541 |  KEGG hsa:54541
Gene Symbol DDIT4
Protein Name DNA damage inducible transcript 4
Synonyms Dig2|REDD-1|REDD1
Ortholog resource in our bank

  DDIT4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005961 IRAK014P01 pCMV-SPORT6 BC015236 NM_019058 Full
HGY083050 IRAL007K10 pOTB7 BC000708 NM_019058 Full
HGY087137 IRAL017O01 pOTB7 BC007714 NM_019058 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040833 ARe02B09 pKA1U5 NM_019058.2  
GGCAGCAGGCCAAGGGGGAGGTGCGAGCGTGGACCTGGGACGGGTCTGGGCGGCTCTCGG
HKR235110 ARiS087M22 pGCAP10 NM_019058.2  
HKR330149 RBb25G05 pGCAP1 NM_019058.2  
GGCAGCAGGCCAAGGGGGAGGTGCGAGCGTGGACCTGGGACGGGTCTGGGCGGCTCTCGG
HKR378098 RBd45E02 pGCAP10 NM_019058.2  
GACGGGTTCGCACACCCATTCAAGCGGCAGGACGCACTTGTCTTAGCAGTTCTCGCTGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl