Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFB11

Gene ID (NCBI) 54539
Gene Symbol NDUFB11
Protein Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa
Synonyms CI-ESSS|ESSS|NP17.3|Np15|P17.3
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005419 IRAK013J03 pCMV-SPORT6 BC010665 NM_019056 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE024697 W01A061M09 pENTR-TOPO flj0060p10 AK000501 NM_019056
HGE024701 W01A061M13 pENTR-TOPO flj0060p10 AK000501 NM_019056

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR046874 ARe17D02 pKA1U5 NM_019056.4
GCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTT
HKR050830 ARe27B06 pKA1U5 NM_019056.4
GGAGACCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGT
HKR073229 ARe83B05 pKA1U5 NM_019056.4
AGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTTGGCGGC
HKR073347 ARe83G03 pKA1U5 NM_019056.4
AGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTTGGCGGC
HKR218144 ARiS045F24 pGCAP10 NM_019056.4
GCTTTCCCCGCCCCTGAGACCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTT
HKR238592 ARiS096H24 pGCAP10 NM_019056.4
CGGCCGGCCGATGATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTT
HKR248865 ARiS122C17 pGCAP10 NM_019056.4
AGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTTGGCGGC
HKR260177 ARiS150H09 pGCAP10 NM_019056.4
GAGACCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTC
HKR366075 RBd15D03 pGCAP10 NM_019056.4
GACCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTT
HKR396012 RBd90A12 pGCAP10 NM_019056.4
GGAGACCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGT
HKR396148 RBd90G04 pGCAP10 NM_019056.4
GGAGACCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGT
HKR461720 RBdS154E24 pGCAP10 NM_019056.4
GGCATTTCTTTCCCCGCCCCTGAGACCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGT
HKR470909 RBdS177E13 pGCAP10 NM_019056.4
GCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl