Prev. |  KEGG KO K02835 > 

RIKEN DNA Bank Human Resource - MTRF1L

Gene ID NCBI Gene 54516 |  KEGG hsa:54516
Gene Symbol MTRF1L
Protein Name mitochondrial translational release factor 1 like
Synonyms HMRF1L|MRF1L|mtRF1a
Ortholog resource in our bank

  MTRF1L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091210 IRAL028A10 pOTB7 BC011873 NM_019041 Full
HGY091908 IRAL029M20 pOTB7 BC014428 NM_019041 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099240 M01C048B16 pDONR221 MGC13-H08 BC011873 ENST00000367233  
HGE099288 M01C048D16 pDONR221 MGC13-H08 BC011873 ENST00000367233  
HGE099336 M01C048F16 pDONR221 MGC13-H08 BC011873 ENST00000367233  
HGE099384 M01C048H16 pDONR221 MGC13-H08 BC011873 ENST00000367233  
HGE099432 M01C048J16 pDONR221 MGC13-H08 BC011873 ENST00000367233  
HGE099480 M01C048L16 pDONR221 MGC13-H08 BC011873 ENST00000367233  
HGE099528 M01C048N16 pDONR221 MGC13-H08 BC011873 ENST00000367233  
HGE099576 M01C048P16 pDONR221 MGC13-H08 BC011873 ENST00000367233  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048554 ARe21G10 pKA1U5 NM_019041.5  
GATGCGGTCCCGGGTTCTGTGGGGCGCTGCCCGGTGGCTCTGGCCCCGCCGGGCCGTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl