Prev. | 

RIKEN DNA Bank Human Resource - ADAMTSL4

Gene ID NCBI Gene 54507 |  KEGG hsa:54507
Gene Symbol ADAMTSL4
Protein Name ADAMTS like 4
Synonyms ADAMTSL-4|ECTOL2|TSRC1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103504 IRAL058M16 pOTB7 BC071852 NM_025008 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR077307 ARe93E11 pKA1U5 NM_019032.4  
GGGGCCCCAGCTGGCCGCCGCGGAGCGAGGTTGCCTGGAGAGAGCGCCTGGGCGCAGAAG
HKR165635 ARi14B11 pGCAP10 NM_019032.4  
GAGTGTGGAGAGGTGTGGCCAGGAGGAGCCCGCGTTTGTCCAGACCAAGGTCTACTCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl