Prev. |  KEGG KO K09645 > 

RIKEN DNA Bank Human Resource - CPVL

Gene ID NCBI Gene 54504 |  KEGG hsa:54504
Gene Symbol CPVL
Protein Name carboxypeptidase, vitellogenic like
Synonyms HVLP
Ortholog resources KEGG ortholog (KEGG orthology K09645) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046104 ARe15E08 pKA1U5 NM_031311.3  
GAGGAGCACCGACTGCGCCGCACCCTGAGAGATGGTTGGTGCCATGTGGAAGGTGATTGT
HKR279456 ARiS198K16 pGCAP10 NM_031311.3  
GACTCACTTCTGCCTGATTTGGGAAGCGCTGCAAGGACAACCGGCTGGGGTCCTTGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl