Prev. |  KEGG KO K20032 > 

RIKEN DNA Bank Human Resource - ZDHHC13

Gene ID NCBI Gene 54503 |  KEGG hsa:54503
Gene Symbol ZDHHC13
Protein Name zinc finger DHHC-type palmitoyltransferase 13
Synonyms HIP14L|HIP3RP
Ortholog resource in our bank

  ZDHHC13

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047921 IRAK119N09 pCMV-SPORT6 BC056152 NM_019028 Full
HGY019284 IRAK048D12 pBluescriptR BC036020 NM_019028 Full/var
HGX044304 IRAK110M16 pCMV-SPORT6 BC050690 NM_001001483 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003009 W01A007I17 pENTR-TOPO IRAK119N09 BC056152 NM_019028  
HGE003011 W01A007I19 pENTR-TOPO IRAK119N09 BC056152 NM_019028  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR470970 RBdS177H02 pGCAP10 NM_001001483.1  
GGCCAGCAGGAAGTGGGAGAAGAGGCGACCCAAGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl