Prev. | 

RIKEN DNA Bank Human Resource - FAM105A

Gene ID NCBI Gene 54491 |  KEGG hsa:54491
Gene Symbol FAM105A
Protein Name family with sequence similarity 105 member A
Synonyms NET20
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005495 IRAK013M07 pCMV-SPORT6 BC011524 NM_019018 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR385279 RBd63D07 pGCAP10 NM_019018.2  
GCGCAGCGCGGCCGGCATGGCGGCGACAAGGAGCCCCACGCGGGCAAGGGAGCGGGAGCG
HKR475126 RBdS187N14 pGCAP10 NM_019018.2  
GGCCGGCGGGCGGCCGTCGCGTCTGACAGACCACTGCAGACCACGGGCCGAGGCCCAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl