Prev. |  KEGG KO K18419 > 

RIKEN DNA Bank Human Resource - DGCR8

Gene ID NCBI Gene 54487 |  KEGG hsa:54487
Gene Symbol DGCR8
Protein Name DGCR8 microprocessor complex subunit
Synonyms C22orf12|DGCRK6|Gy1|pasha
Ortholog resource in our bank

  DGCR8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067491 IRAK168M03 pBluescriptR BC071568 NM_022720 Full/var
HGX069739 IRAK174F19 pCMV-SPORT6 BC078147 NM_022720 Full/var
HGY090514 IRAL026E18 pOTB7 BC009323 NM_022720 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR371776 RBd29H08 pGCAP10 NM_022720.5  
ATGTGGCCAGCTTGACTAAGCCGCCAGCGCACAGCGCGGCAGGACGCGCCCGGGTCTCAG
HKR408922 RBdS022F02 pGCAP10 NM_022720.5  
GGTGAGGCAACATGGCCGCGGGCGGTGGAGAGCGCGGGGTGGGGACCCCTCCGGGGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl