Prev. | 

RIKEN DNA Bank Human Resource - PIMREG

Gene ID NCBI Gene 54478 |  KEGG hsa:54478
Gene Symbol PIMREG
Protein Name PICALM interacting mitotic regulator
Synonyms CATS|FAM64A|RCS1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081381 IRAL003H13 pOTB7 BC013966 NM_019013 Full/var
HGY083407 IRAL008I15 pOTB7 BC005004 NM_019013

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045630 ARe14B06 pKA1U5 NM_019013.1  
TGGGCTGCGGTGGGCGAGGAGCAGCTGTGCTGCGGCTGTGCTCGGCCTTAGTGGTGTCGG
HKR368901 RBd22E05 pGCAP10 NM_019013.1  
HKR390879 RBd77D07 pGCAP10 NM_019013.1  
GGTGCTGCGGCTGTGCTCGGCCTTAGTGGTGTCGGGGTCTAGTGGACAGAGAAGACTCTT
HKR409182 RBdS022P22 pGCAP10 NM_019013.1  
GGTGCTGCGGCTGTGCTCNGNCTTAGTGNTGTCGGGGTCTAGTGGACANANAANACTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl