Prev. | 

RIKEN DNA Bank Human Resource - PLEKHA5

Gene ID NCBI Gene 54477 |  KEGG hsa:54477
Gene Symbol PLEKHA5
Protein Name pleckstrin homology domain containing A5
Synonyms PEPP-2|PEPP2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001232 IRAK003B08 pCMV-SPORT6 BC013133 NM_019012 Partial
HGX001260 IRAK003C12 pCMV-SPORT6 BC000969 NM_019012 Partial/var
HGY080900 IRAL002E04 pOTB7 BC004164 NM_019012 Partial/var
HGY102906 IRAL057E10 pDNR-LIB BC070174 NM_019012 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR444179 RBdS110H11 pGCAP10 NM_019012.3  
GGTTCCCTCCTCCCTCGGCAGCCGCGGCGGCAGCAGGAGAAGGCGGCGGCGGCGGCTAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl