Prev. | 

RIKEN DNA Bank Human Resource - ARMCX6

Gene ID NCBI Gene 54470 |  KEGG hsa:54470
Gene Symbol ARMCX6
Protein Name armadillo repeat containing, X-linked 6
Synonyms GASP10
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085009 IRAL012I17 pOTB7 BC007677 NM_019007 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235166 ARiS087P06 pGCAP10 NM_019007.3  
GAGAGCACAAGTCCTGCTAGTCGCCTCCGTCTGGGTACCAGCCCCCTATTACTCTGCAGG
HKR362858 RBd07C10 pGCAP10 NM_019007.3  
GACGTGACCAAGAGCCGCCTAGAGCACAAGTCCTGCTAGTCGCCTCCGTCTGGGTACCAG
HKR378108 RBd45E12 pGCAP10 NM_019007.3  
TACGTGACCAAGAGCCGCCTAGAGCACAAGTCCTGCTAGTCGCCTCCGTCTGGGTACCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl