Prev. | 

RIKEN DNA Bank Human Resource - ZFAND6

Gene ID NCBI Gene 54469 |  KEGG hsa:54469
Gene Symbol ZFAND6
Protein Name zinc finger AN1-type containing 6
Synonyms AWP1|ZA20D3|ZFAND5B
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086532 IRAL016F12 pDNR-LIB BC005283 NM_019006

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096423 M01C041A23 pDONR221 MGC10-A12 BC005283 NM_019006  
HGE096471 M01C041C23 pDONR221 MGC10-A12 BC005283 NM_019006  
HGE096519 M01C041E23 pDONR221 MGC10-A12 BC005283 NM_019006  
HGE096567 M01C041G23 pDONR221 MGC10-A12 BC005283 NM_019006  
HGE096615 M01C041I23 pDONR221 MGC10-A12 BC005283 NM_019006  
HGE096663 M01C041K23 pDONR221 MGC10-A12 BC005283 NM_019006  
HGE096711 M01C041M23 pDONR221 MGC10-A12 BC005283 NM_019006  
HGE096759 M01C041O23 pDONR221 MGC10-A12 BC005283 NM_019006  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168175 ARi20H07 pGCAP10 NM_019006.2  
GAAACAGCGGACGGAGGGGCCGGCGGTGGCGGAGCCGGAGCAAGCAGGGGTTCGGCGGCA
HKR169259 ARi23C11 pGCAP10 NM_019006.2  
GAGAAAAGTTTAATAAACAGCGGACGGAGGGGCCGGCGGTGGCGGAGCCGGAGCAAGCAG
HKR180574 ARi51H06 pGCAP10 NM_019006.2  
GGGACGGAGGGGCCGGCGGTGGCGGAGCCGGAGCAAGCAGGGGTTCGGCGGCATTACCTG
HKR394852 RBd87C04 pGCAP10 NM_019006.2  
GATTCAGGTTTGGTTGCTTTGGAGTACAGCTTCAAGTGAAGTTAATCTGAGGTGAAGCAA
HKR416022 RBdS040A22 pGCAP10 NM_019006.2  
GGGAGGGGCCGGCGGTGGCGGAGCCGGAGCAAGCAGGGGTTCGGCGGCATTACCTGTACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl