Prev. |  KEGG KO K20407 > 

RIKEN DNA Bank Human Resource - MIOS

Gene ID NCBI Gene 54468 |  KEGG hsa:54468
Gene Symbol MIOS
Protein Name meiosis regulator for oocyte development
Synonyms MIO|Sea4|Yulink
Ortholog resource in our bank

  MIOS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067263 IRAK168C15 pBluescriptR BC068512 NM_019005 Full
HGY084694 IRAL011M06 pOTB7 BC005883 NM_019005 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR323658 RBb09C10 pKA1U5 NM_019005.3  
TGGGCTCCGCGNTCCTCCAGGCGTGGTGGTGGGGTCGTGGGTCCCAGCCCAGTGGTCCAG
HKR374459 RBd36C11 pGCAP10 NM_019005.3  
GGGAAGCGGCTGTGCGGCGGCCGCGCTGCCACCTCAGTGAATGGACCTGAGTGGACCCTT
HKR433362 RBdS083G18 pGCAP10 NM_019005.3  
GCAGTGAGCGCGACCCGGTCCGCGTCTCGACTCTCGGGAGCGCCGCGGCCGCAGCGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl