Prev. |  KEGG KO K11967 > 

RIKEN DNA Bank Human Resource - ANKIB1

Gene ID NCBI Gene 54467 |  KEGG hsa:54467
Gene Symbol ANKIB1
Protein Name ankyrin repeat and IBR domain containing 1
Synonyms -
Ortholog resource in our bank

  ANKIB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001490 IRAK003M02 pCMV-SPORT6 BC031483 XM_940258 Partial/var
HGX056581 IRAK141H13 pCMV-SPORT6 BC063861 XM_940258 Partial
HGX066434 IRAK166B10 pCMV-SPORT6 BC073893 XM_940258 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174009 ARi35A09 pGCAP10 NM_019004.1  
GGCTGCCGTTCCTGCTCCTTTTCACTGGACCTGCAGTCTCTCAGGGGCTGGTGGCAGGCG
HKR174900 ARi37E04 pGCAP10 NM_019004.1  
GGCTGCCGTTCCTGCTCCTTTTCACTGGACCTGCAGTCTCTCAGGGGCTGGTGGCAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl