Prev. | 

RIKEN DNA Bank Human Resource - SPIN2A

Gene ID NCBI Gene 54466 |  KEGG hsa:54466
Gene Symbol SPIN2A
Protein Name spindlin family member 2A
Synonyms DXF34|SPIN2|TDRD25|dJ323P24.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066626 IRAK166J10 pCMV-SPORT6 BC071694 NM_019003 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR332156 RBb30G12 pGCAP1 NM_019003.3  
GGCGAGCCAAGCGGTGGGGACGCCGCTGCCTTCCTCTTTGCCTGTCTCGCCGCCCTCCTA
HKR441865 RBdS104L01 pGCAP10 NM_019003.3  
TGGCCTGTCTCGCCGCCCTCCTAGACACGCTCCTCATCTACGGATCCTACCCTCCCCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl