Prev. |  KEGG KO K10263 > 

RIKEN DNA Bank Human Resource - FBXW5

Gene ID NCBI Gene 54461 |  KEGG hsa:54461
Gene Symbol FBXW5
Protein Name F-box and WD repeat domain containing 5
Synonyms Fbw5
Ortholog resource in our bank

  FBXW5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019499 IRAK048M11 pBluescriptR BC031100 NM_018998 Full/var
HGX020549 IRAK051G05 pCMV-SPORT6 BC035355 NM_018998 Full/var
HGY086139 IRAL015F19 pOTB7 BC004541 NM_018998 Partial
HGY088881 IRAL022D09 pOTB7 BC009429 NM_018998 Partial
HGY090277 IRAL025L13 pOTB7 BC014297 NM_018998 Full
HGY092289 IRAL030M01 pOTB7 BC014130 NM_018998 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049255 ARe23C07 pKA1U5 NM_018998.2  
GGGGGCGGCGCAGCGGGCGGAGGCGGCCGTGCCCTTNNTGGGCAGAATGTCACGATGGAC
HKR408843 RBdS022B19 pGCAP10 NM_018998.2  
GGGGCTCCCCGTTGGGCGGGGGCGGCGGTCCGAGCGGCTGCGGCAGCGGAAGCGGGTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl