Prev. |  KEGG KO K11128 > 

RIKEN DNA Bank Human Resource - GAR1

Gene ID NCBI Gene 54433 |  KEGG hsa:54433
Gene Symbol GAR1
Protein Name GAR1 ribonucleoprotein
Synonyms NOLA1
Ortholog resources KEGG ortholog (KEGG orthology K11128) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04813 SEREX clone NGO-Pr-168 (ID 2521) #1 SEREX clone NGO-Pr-168 (ID 2521) #1
RDB06703 pET_hsNOLA1 Prokaryotic expression vector of human NOLA1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001484 IRAK003L20 pCMV-SPORT6 BC003413 NM_032993 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE105610 M01C064A10 pDONR221 06_06-F05 BC003413 NM_032993  
HGE105658 M01C064C10 pDONR221 06_06-F05 BC003413 NM_032993  
HGE105706 M01C064E10 pDONR221 06_06-F05 BC003413 NM_032993  
HGE105754 M01C064G10 pDONR221 06_06-F05 BC003413 NM_032993  
HGE105802 M01C064I10 pDONR221 06_06-F05 BC003413 NM_032993  
HGE105850 M01C064K10 pDONR221 06_06-F05 BC003413 NM_032993  
HGE105898 M01C064M10 pDONR221 06_06-F05 BC003413 NM_032993  
HGE105946 M01C064O10 pDONR221 06_06-F05 BC003413 NM_032993  
HGE124423 M01C111A23 pDONR221 06-2_04-A12 BC003413 NM_032993  
HGE124471 M01C111C23 pDONR221 06-2_04-A12 BC003413 NM_032993  
HGE124519 M01C111E23 pDONR221 06-2_04-A12 BC003413 NM_032993  
HGE124567 M01C111G23 pDONR221 06-2_04-A12 BC003413 NM_032993  
HGE124615 M01C111I23 pDONR221 06-2_04-A12 BC003413 NM_032993  
HGE124663 M01C111K23 pDONR221 06-2_04-A12 BC003413 NM_032993  
HGE124711 M01C111M23 pDONR221 06-2_04-A12 BC003413 NM_032993  
HGE124759 M01C111O23 pDONR221 06-2_04-A12 BC003413 NM_032993  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR020875 ARa52D03 pKA1U5 NM_018983.3  
TTGGTGTGTGCGCAAGGCCAGGGCCAGAGGGGCACGTGGCGCCGGGAGGAGAGAGAATGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl