Prev. |  KEGG KO K11113 > 

RIKEN DNA Bank Human Resource - TERF2IP

Gene ID NCBI Gene 54386 |  KEGG hsa:54386
Gene Symbol TERF2IP
Protein Name TERF2 interacting protein
Synonyms DRIP5|RAP1
Ortholog resource in our bank

  TERF2IP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069690 IRAK174D18 pCMV-SPORT6 BC078171 NM_018975 Full
HGY081007 IRAL002I15 pOTB7 BC005841 NM_018975 Full
HGY083957 IRAL009O21 pOTB7 BC004465 NM_018975 Full
HGY092863 IRAL032C15 pDNR-LIB BC016739 NM_018975 Full/var
HGY094152 IRAL035G08 pDNR-LIB BC022428 NM_018975

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE029342 W01A073F22 pENTR-TOPO IRAL035G08 BC022428 NM_018975  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234982 ARiS087H14 pGCAP10 NM_018975.2  
GAGTGCTGCGCTTCGCGGCAGAGGCGTCTGCGGTGACAGCTCAGTCAGTTGAGCTCTGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl