Prev. |  KEGG KO K09659 > 

RIKEN DNA Bank Human Resource - DPM3

Gene ID NCBI Gene 54344 |  KEGG hsa:54344
Gene Symbol DPM3
Protein Name dolichyl-phosphate mannosyltransferase subunit 3, regulatory
Synonyms CDG1O
Ortholog resource in our bank

  DPM3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019887 IRAK049L23 pCMV-SPORT6 BC032223 NM_153741 Full
HGX056016 IRAK140A16 pCMV-SPORT6 BC065233 NM_153741 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019349 W01A048G05 pENTR-TOPO IRAK049L23 BC032223 NM_153741  
HGE019351 W01A048G07 pENTR-TOPO IRAK049L23 BC032223 NM_153741  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR339356 RBb48G12 pGCAP1 NM_153741.1  
AACATCCGGGCCGCGCGGGGAAGGGGAGACGTGGGGTAGAGGGGAGCATTGCTTCCTTCT
HKR384059 RBd60C11 pGCAP10 NM_153741.1  
GGACTTCCGGACGCCAACATCCGGGCCGCGCGGGGAAGGGGAGACGTGGGGTAGAGTGAC
HKR392170 RBd80H02 pGCAP10 NM_153741.1  
GATCCGGGCCGCGCGGGGAAGGGGAGACGTGGGGTAGAGTGACCATGACGAAATTAGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl