Prev. |  KEGG KO K08738 > 

RIKEN DNA Bank Human Resource - CYCS

Gene ID NCBI Gene 54205 |  KEGG hsa:54205
Gene Symbol CYCS
Protein Name cytochrome c, somatic
Synonyms CYC|HCS|THC4
Ortholog resources KEGG ortholog (KEGG orthology K08738) in the DNA Bank
Featured content Apoptosis - human
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY066953 IRAK167G09 pBluescriptR BC068464 NM_018947 Full/var
HGY086665 IRAL016L01 pDNR-LIB BC005299 NM_018947 Full
HGY088436 IRAL021B12 pDNR-LIB BC008477 NM_018947 Full
HGY088477 IRAL021D05 pDNR-LIB BC009587 NM_018947 Full
HGY088480 IRAL021D08 pDNR-LIB BC008475 NM_018947 Full
HGY088499 IRAL021E03 pDNR-LIB BC009578 NM_018947 Full
HGY088591 IRAL021H23 pDNR-LIB BC009602 NM_018947 Full
HGY088626 IRAL021J10 pDNR-LIB BC009607 NM_018947 Full
HGY088645 IRAL021K05 pDNR-LIB BC009579 NM_018947 Full
HGY088661 IRAL021K21 pDNR-LIB BC009582 NM_018947 Full
HGY092509 IRAL031E13 pDNR-LIB BC014359 NM_018947 Full
HGY092530 IRAL031F10 pDNR-LIB BC015130 NM_018947 Full/var
HGY092537 IRAL031F17 pDNR-LIB BC014361 NM_018947 Full
HGY092955 IRAL032G11 pDNR-LIB BC021994 NM_018947 Full
HGY094285 IRAL035L21 pDNR-LIB BC022330 NM_018947 Full
HGY095337 IRAL038F17 pDNR-LIB BC016006 NM_018947 Full
HGY100462 IRAL051C14 pDNR-LIB BC067222 NM_018947 Full
HGY102803 IRAL057A03 pDNR-LIB BC070346 NM_018947 Full
HGY102899 IRAL057E03 pDNR-LIB BC071761 NM_018947 Full
HGY103006 IRAL057I14 pDNR-LIB BC070156 NM_018947 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096401 M01C041A01 pDONR221 MGC10-A01 BC005299 NM_018947  
HGE096449 M01C041C01 pDONR221 MGC10-A01 BC005299 NM_018947  
HGE096497 M01C041E01 pDONR221 MGC10-A01 BC005299 NM_018947  
HGE096545 M01C041G01 pDONR221 MGC10-A01 BC005299 NM_018947  
HGE096593 M01C041I01 pDONR221 MGC10-A01 BC005299 NM_018947  
HGE096641 M01C041K01 pDONR221 MGC10-A01 BC005299 NM_018947  
HGE096689 M01C041M01 pDONR221 MGC10-A01 BC005299 NM_018947  
HGE096737 M01C041O01 pDONR221 MGC10-A01 BC005299 NM_018947  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR067274 ARe68D02 pKA1U5 NM_018947.4  
GAGAGAGTGGGGACGTCCGGCTTCGGAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAAG
HKR163612 ARi09A12 pGCAP10 NM_018947.4  
GAGAGAGTGGGGACGTCCGGCTTCGGAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAAG
HKR180435 ARi51B11 pGCAP10 NM_018947.4  
GGAGAGTGGGGACGTCCGGCTTCGGAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAAGA
HKR187607 ARi69A07 pGCAP10 NM_018947.4  
GGTCAGGGCGCGGGAGCGCGGAGCGAGTTTGGTTGCACTTACACCGGTACTTAAGCGCGG
HKR218215 ARiS045I23 pGCAP10 NM_018947.4  
TGANAGAGTGGGNACGTCCNGCTTCNGAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAA
HKR222253 ARiS055K13 pGCAP10 NM_018947.4  
GAGAGAGTGGGGACGTCCGGCTTCGGAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAAG
HKR321775 RBb04H07 pKA1U5 NM_018947.4  
TGAGAGAGTGGGGACGTCCGGCTTCGGAGCGGNAGTGTTCGTTGTGCCAGCGACTAAAAA
HKR322008 RBb05A08 pKA1U5 NM_018947.4  
GAGAGAGTGGGGACGTCCGGCTTCGGAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAAG
HKR324928 RBb12F08 pKA1U5 NM_018947.4  
GAGAGAGTGGGGACGTCCGGCTTCGGAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAAG
HKR333204 RBb33A04 pGCAP1 NM_018947.4  
HKR372108 RBd30E12 pGCAP10 NM_018947.4  
GAGAGAGTGGGGACGTCCGGCTTCGGAGCGGGAGTGTTCGTTGTGCCAGCGACTAAAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl