Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NANS

Gene ID (NCBI) 54187
Gene Symbol NANS
Protein Name N-acetylneuraminic acid synthase
Synonyms SAS
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082921 IRAL007F01 pOTB7 BC000008 NM_018946 Full
HGY083679 IRAL009D07 pOTB7 BC019315 NM_018946 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR041655 ARe04C07 pKA1U5 NM_018946.2
AGAACAGAGTAGAGGCGGCGGCGGCGGCGGCCGGACCCAGACTGGTAGTGAGGCGTTGGA
HKR063627 ARe59B03 pKA1U5 NM_018946.2
GAGAACAGAGTAGAGGCGGCGGCGGCGGCGGCCGGACCCAGACTGGTAGTGAGGCGTTGG
HKR209396 ARiS023I04 pGCAP10 NM_018946.2
GAGAGTAGAGGCGGCGGCGGCGGCGGCCGGACCCAGACTGGTAGTGAGGCTTTGGACCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl