Prev. | 

RIKEN DNA Bank Human Resource - PTOV1

Gene ID NCBI Gene 53635 |  KEGG hsa:53635
Gene Symbol PTOV1
Protein Name PTOV1 extended AT-hook containing adaptor protein
Synonyms ACID2|PTOV-1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008927 IRAK022F07 pCMV-SPORT6 BC015172 NM_017432 Partial
HGY097982 IRAL044P22 pOTB7 BC042921 NM_017432 Full
HGY100225 IRAL050J09 pOTB7 BC065486 NM_017432 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162828 ARi07B04 pGCAP10 NM_017432.3  
GACTCCGGCGGCGCGTCCCCCGAGCTTGGTACGGCTCAGCCCGTCTCCCCCGAAGCCGCG
HKR186105 ARi65E09 pGCAP10 NM_017432.3  
GAGTGGTTCGGCCGCGGCGACCCCACTCCGGCGGCGCGTCCCCCGAGCTTGGTACG?CTC
HKR321635 RBb04B11 pKA1U5 NM_017432.3  
GACGGCTCAGCCCGTCTCCCCCGAAGCCGCGCGCCCGCGCCCGCGCCCCTCAGTCGGTGG
HKR374974 RBd37H06 pGCAP10 NM_017432.3  
GACTCCGGCGGCGCGTCCCCCGAGCTTGGTACGGCTCAGCCCGTCTCCCCCGAAGCCGCG
HKR398902 RBd97E06 pGCAP10 NM_017432.3  
GACTCCGGCGGCGCGTCCCCCGAGCTTGGTACGGCTCAACCCGTCTCCCCCGAAGCCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl