Prev. |  KEGG KO K13988 > 

RIKEN DNA Bank Human Resource - NUDT9

Gene ID NCBI Gene 53343 |  KEGG hsa:53343
Gene Symbol NUDT9
Protein Name nudix hydrolase 9
Synonyms NUDT10
Ortholog resource in our bank

  NUDT9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082019 IRAL005A19 pOTB7 BC000542 NM_198039 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348529 RBb71F09 pGCAP1 NM_024047.3  
TGGAGATTACGCAGAGAGAAAGTTACGAGGTTCGTGGCCGCGGTTTCCCCAGGCAGCTGG
HKR430327 RBdS075N15 pGCAP10 NM_024047.3  
GAGATACCCGCGGCCGGGACTCGGAGCTGTGGGGTGTGGGGAGGCGGAGGCACCAACTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl