Prev. |  KEGG KO K10477 > 

RIKEN DNA Bank Human Resource - BTBD1

Gene ID NCBI Gene 53339 |  KEGG hsa:53339
Gene Symbol BTBD1
Protein Name BTB domain containing 1
Synonyms C15orf1|NS5ATP8
Ortholog resources KEGG ortholog (KEGG orthology K10477) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025098 IRAK062M10 pCMV-SPORT6 BC028097 NM_025238 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE085616 M01C014A16 pDONR221 FLJ04-F08 AK000731 NM_025238  
HGE085664 M01C014C16 pDONR221 FLJ04-F08 AK000731 NM_025238  
HGE085712 M01C014E16 pDONR221 FLJ04-F08 AK000731 NM_025238  
HGE085760 M01C014G16 pDONR221 FLJ04-F08 AK000731 NM_025238  
HGE085808 M01C014I16 pDONR221 FLJ04-F08 AK000731 NM_025238  
HGE085856 M01C014K16 pDONR221 FLJ04-F08 AK000731 NM_025238  
HGE085904 M01C014M16 pDONR221 FLJ04-F08 AK000731 NM_025238  
HGE085952 M01C014O16 pDONR221 FLJ04-F08 AK000731 NM_025238  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209216 ARiS023A16 pGCAP10 NM_025238.3  
GGCCTTTCCCGGAAGGCAGGGAGGCAGCGCCGGCCTCCGGAGGCGGCCTGGGCGATGGCG
HKR397625 RBd94B01 pGCAP10 NM_025238.3  
GAGGGAGGGGCCTGCGGAGGCGCGAGGCCCCCGGAAGCGCCTTTCCCGGAAGGCAGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl