RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - STK26

Gene ID	NCBI Gene 51765 \| KEGG hsa:51765
Gene Symbol	STK26
Protein Name	serine/threonine kinase 26
Synonyms	MASK\|MST4

Ortholog resource in our bank

  STK26

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number	Clone name	Vector	Constructed from⁽¹⁾		CDS comparison		Status
Catalog number	Clone name	Vector	Clone ID	Sequence (DDBJ)	Refered mRNA	CDS status	Status
HGE024979	W01A062H11	pENTR-TOPO	flj0019a17	AK075150	NM_016542

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR072058	ARe80C10	pKA1U5	NM_016542.3
HKR072058	GAGCGGCGGGCGGGCGCCAGAAAGGTAGACTGAGTCCCAGGGAGCTGCGCCGCTAACAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl